View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13382_low_37 (Length: 304)

Name: NF13382_low_37
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13382_low_37
NF13382_low_37
[»] chr3 (2 HSPs)
chr3 (19-284)||(32576296-32576571)
chr3 (240-282)||(12733056-12733098)
[»] chr7 (2 HSPs)
chr7 (25-126)||(19885389-19885489)
chr7 (232-277)||(19885245-19885290)
[»] scaffold0464 (1 HSPs)
scaffold0464 (240-282)||(9661-9703)
[»] chr6 (1 HSPs)
chr6 (25-91)||(14751454-14751520)
[»] scaffold0479 (1 HSPs)
scaffold0479 (240-270)||(3699-3729)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 32576571 - 32576296
Alignment:
19 ggtggagatgatgatgagtgtttgagttagctcaactcaagggaagccaacttggtggtttatatttgctttgggagtctgtgtcatctcaataaaggag 118  Q
    ||||||||||||||| |||||||||||| |||||||||||  |||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||    
32576571 ggtggagatgatgattagtgtttgagttggctcaactcaaacgaagccaacttggtggtttatatttgctttggaagtccgtgtcatctcaat-aaggag 32576473  T
119 cagtatttcaagacaggaagtggggtgcctgaaaaggatttcttcgg-----------gtatggtaaagcatcttgtgtgcagtagagagtttcaaattc 207  Q
    || ||||| | ||||| | |||||||||||| |||||| ||||||||           |||||||||||||| ||| ||| ||||||| |||||||||||    
32576472 caatatttgatgacagaaggtggggtgcctggaaaggacttcttcgggcggttcccgtgtatggtaaagcattttgcgtgtagtagagggtttcaaattc 32576373  T
208 aatagggatggtggtgtggggataggtgccacagaggttgatcttgaaataccctgcaattgttgttggagtgccca 284  Q
    | |||||||||||||| | || |||| |||||| ||||||||||||||| ||||||||||||| ||| |||||||||    
32576372 agtagggatggtggtgagaggctaggggccacataggttgatcttgaaacaccctgcaattgtggttagagtgccca 32576296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 240 - 282
Target Start/End: Complemental strand, 12733098 - 12733056
Alignment:
240 agaggttgatcttgaaataccctgcaattgttgttggagtgcc 282  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
12733098 agaggttgatcttgaaataccctgcaattgtggttggagtgcc 12733056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 25 - 126
Target Start/End: Complemental strand, 19885489 - 19885389
Alignment:
25 gatgatgatgagtgtttgagttagctcaactcaagggaagccaacttggtggtttatatttgctttgggagtctgtgtcatctcaataaaggagcagtat 124  Q
    |||||||||||||||||||||| ||||||||| ||||||||||| | |||||||||||||||||||| || ||| |||  ||||||| ||||||||||||    
19885489 gatgatgatgagtgtttgagttggctcaactcgagggaagccaattcggtggtttatatttgctttgtgaatctctgttgtctcaat-aaggagcagtat 19885391  T
125 tt 126  Q
    ||    
19885390 tt 19885389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 277
Target Start/End: Complemental strand, 19885290 - 19885245
Alignment:
232 ggtgccacagaggttgatcttgaaataccctgcaattgttgttgga 277  Q
    ||||||||||||||||||||||||| | |||| |||||| ||||||    
19885290 ggtgccacagaggttgatcttgaaacatcctgtaattgtggttgga 19885245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0464 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0464
Description:

Target: scaffold0464; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 240 - 282
Target Start/End: Original strand, 9661 - 9703
Alignment:
240 agaggttgatcttgaaataccctgcaattgttgttggagtgcc 282  Q
    ||||||||||||||||||||||||||||||| |||||||||||    
9661 agaggttgatcttgaaataccctgcaattgtggttggagtgcc 9703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 91
Target Start/End: Original strand, 14751454 - 14751520
Alignment:
25 gatgatgatgagtgtttgagttagctcaactcaagggaagccaacttggtggtttatatttgctttg 91  Q
    |||||||||||||| |||| ||  |||||||| ||||||||||| | || |||||||||||||||||    
14751454 gatgatgatgagtgcttgatttgactcaactcgagggaagccaattcggaggtttatatttgctttg 14751520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0479 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0479
Description:

Target: scaffold0479; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 270
Target Start/End: Original strand, 3699 - 3729
Alignment:
240 agaggttgatcttgaaataccctgcaattgt 270  Q
    |||||||||||||||||||||||||||||||    
3699 agaggttgatcttgaaataccctgcaattgt 3729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University