View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_low_47 (Length: 239)
Name: NF13382_low_47
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 31543741 - 31543943
Alignment:
| Q |
19 |
gaaaccacccaaaaaggatgataaaagatattattttaggccacatattgatatcatctacaaagttaataatgccattattatatagtttaaggctcca |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31543741 |
gaaaccactcaaaaaggatgataaaagatattattttaggccacatattgatatgatctacaaagttaataatgccattattatatagtttaaggctcca |
31543840 |
T |
|
| Q |
119 |
aactagtcttagtgataccatgctttttcttgctgataaaaacacagttcatgtgacctcaaagtggggtttggaatcagaaaataaacaatttgtgaat |
218 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31543841 |
aactagtcttagtaataccatgcttttgcttgctgataaaaacacagttcatgtgacctcaaagtggggtttggaatcagaaaataaacaatttgtgaat |
31543940 |
T |
|
| Q |
219 |
att |
221 |
Q |
| |
|
||| |
|
|
| T |
31543941 |
att |
31543943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University