View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13382_low_52 (Length: 228)
Name: NF13382_low_52
Description: NF13382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13382_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 1721072 - 1720897
Alignment:
| Q |
18 |
aaaagaaacaaaaacagtgttaccagaaataacactaacggtacttgcttaaattatcataagttacttagctcaacttcaatgcatactggtggnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1721072 |
aaaagaaacaaaaacagtgttaccagaaataacactaacggtacttgcttaaattatcataagttacttagctcaacttcaatgcatactggtggaaaaa |
1720973 |
T |
|
| Q |
118 |
nncttgcttgcagtgattgcaaacgagagtttttagtgttcacagaaacaactatgtaccgttgcaacaaatgcga |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1720972 |
aacttgcttgcagtgattgcaaacgagagtttttagtgtctacaaaaacaactatgtaccgttgcaacaaatgcga |
1720897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University