View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13383_low_6 (Length: 508)
Name: NF13383_low_6
Description: NF13383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13383_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 224 - 490
Target Start/End: Complemental strand, 14208269 - 14208003
Alignment:
| Q |
224 |
cgaatctcgagtgttctatgtttgcgnnnnnnngtacctgttttcttttgaaccacggtatctgttctaacaaaactattgtctgttggtgttttcaaaa |
323 |
Q |
| |
|
||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14208269 |
cgaatcttgagtgttctatgtttgcgtttttttgtatctgttttcttttgaaccacggtatctgttctaacaaaactattgtctgttggtgttttcaaaa |
14208170 |
T |
|
| Q |
324 |
ggtctgggatattagggggcactcagctagccttttatgggacattaaggagcacaagaagtcggtgacatgcttttcaatttatgaaccactagacagt |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14208169 |
ggtctgggatattagggggcactcagctagccttttatgggacattaaggagcacaagaagtcggtgacatgcttttcaatttatgaaccactagacagt |
14208070 |
T |
|
| Q |
424 |
cttttaagtggatccactgataaaaccataagggtaaggttaaaactttcttttatggtttccactt |
490 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14208069 |
cttttaagtggatccactgataaaaccataagggtaaggttaaaactttattttatggtttccactt |
14208003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 14208491 - 14208307
Alignment:
| Q |
18 |
atcatctttataagtcatcaatgtaaccattttctcttagtcagcaaaatagaaaaatgttgctggtcatacctaactaatgtcagtttctgt------- |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14208491 |
atcatatttataagtcatcaatgtaaccattttctcttattcagcaaaatacaaaaatgttgctggtcatacctaactaatgtcagtttctgtggtgtaa |
14208392 |
T |
|
| Q |
111 |
--------attgaaataataaaacctgttttggtacggttcaggggtaatcatgtaaactagaccatagtgtttaaacacatgtc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14208391 |
atttctgtattgaaataataaaacctgttttggtacggttcaggggtaatcatgtaaactagaccatagtgtttaaacacatgtc |
14208307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 133 - 172
Target Start/End: Complemental strand, 38667556 - 38667517
Alignment:
| Q |
133 |
tggtacggttcaggggtaatcatgtaaactagaccatagt |
172 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
38667556 |
tggtacggttcaggggtaatcttgtaaaccagaccatagt |
38667517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University