View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13386_high_26 (Length: 312)
Name: NF13386_high_26
Description: NF13386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13386_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 5 - 296
Target Start/End: Original strand, 49870709 - 49871000
Alignment:
| Q |
5 |
caccatcacccttgttgttgtattccaaataagtgcatgtctccttgaaaagatttcccatccatggcatataaccctctggtacaaagagaccatcaat |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49870709 |
caccagcacccttgttgttgtattccaaataagtgcatgtctccttgaaaagatttcccatccatggcatgtaaccctctggtacaaagagaccatcaat |
49870808 |
T |
 |
| Q |
105 |
gagagaatccacgataacaaccttggagaagtttctccatggtcttcccaaataagctatcttgggttgcatggtaagtacttcgggttccccggtgaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49870809 |
gagagaatccacgataacaaccttggagaagtttctccatggtcttcccaaataagctatcttgggttgcatggtaagaacttcgggttccccggtgaaa |
49870908 |
T |
 |
| Q |
205 |
tggcagttttggaaaacaagggcggatacactgtcaacattggttcttcctcctgctgtcaccatgcattgttgattttccattggttttct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
49870909 |
tggcagttttggaaaacaagggcggatacactgtcaactttggttcttcctcctgctgtcaccatgcattgttgagttgccattggttttct |
49871000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 5 - 296
Target Start/End: Original strand, 49864772 - 49865063
Alignment:
| Q |
5 |
caccatcacccttgttgttgtattccaaataagtgcatgtctccttgaaaagatttcccatccatggcatataaccctctggtacaaagagaccatcaat |
104 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49864772 |
caccagcacccttgttgttgtattccaaataagtgcatgtctccttgaaaagatttcccatccatggcatataaccctctggtacaaagaggccatcaat |
49864871 |
T |
 |
| Q |
105 |
gagagaatccacgataacaaccttggagaagtttctccatggtcttcccaaataagctatcttgggttgcatggtaagtacttcgggttccccggtgaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49864872 |
gagagaatccacgataacaaccttggagaaatttctccatggtcttcccaaataagctatcttgggttgcatggtaagaacttcgggttccccggtgaaa |
49864971 |
T |
 |
| Q |
205 |
tggcagttttggaaaacaagggcggatacactgtcaacattggttcttcctcctgctgtcaccatgcattgttgattttccattggttttct |
296 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49864972 |
tgacagttttggaaaacaagggcggatacactgtcaactttggttcttcctcctgctgtcaccatgcattgttgatttgccattggttttct |
49865063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University