View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13386_high_27 (Length: 304)
Name: NF13386_high_27
Description: NF13386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13386_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 7430449 - 7430737
Alignment:
| Q |
1 |
ctgcgtaatcgcgacattcggaggtaacgaattcgaagaagatggagacgtaaggtttggatgttgcatagggataactctgataggacgagtcggcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430449 |
ctgcgtaatcgcgacattcggaggtaacgaattcgaagaagatggagacgtaaggtttggatgttgcatagggataactctgataggacgagtcggcatg |
7430548 |
T |
 |
| Q |
101 |
gatgcggcggagggaaggtcggagtaactgtgggatgcgaaggttgttggtgttatctccatgcgcatcagtggtggcgcattggttttgatcggaggcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7430549 |
gatgcggcggagggaaggtcggagtaactgtgggatgcgaaggttgttggtgttatctccatgcgcatcagtggtggcgcattggttttaatcggaggcg |
7430648 |
T |
 |
| Q |
201 |
cgtgagaattgagtagcgcgtggtggtggatgaaatatgaatgtgatggttgagatttgaggaagaactggactgaatgatataacaga |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430649 |
cgtgagaattgagtagcgcgtggtggtggaggaaatgtgaatgtgatggttgagatttgaggaagaactggactgaatgatataacaga |
7430737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University