View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13386_high_29 (Length: 278)
Name: NF13386_high_29
Description: NF13386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13386_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 14 - 260
Target Start/End: Complemental strand, 32668808 - 32668562
Alignment:
| Q |
14 |
tgagatgaagagtgtgaaacgtggaaattggggttcaattttgcgtgatacagggaaagttgttgagaattcaaaatctactgggaagagaaagagtttt |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32668808 |
tgagaagaagagtgtgaaacgtggaaattggggttcaattttgcgtgatacagggaaagttgttgagaattcaaaatctactgggaagagaaagagtttt |
32668709 |
T |
|
| Q |
114 |
catggagagaatagggttactcgttcttgtcccttttataagaaaatgccaggtgaaatgaaatttcttctattttattgatgcattttagttactttct |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32668708 |
catggagagaagagggttactcgttcttgtcccttttataagaaaatgccaggtgaaatgaaatttcttctattttattgatgcattttagttactttct |
32668609 |
T |
|
| Q |
214 |
aggtgtaaatttgtttgaatacatattttctgtttttgtaagttagt |
260 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32668608 |
agttgtaaatttgtttgaatacatattttctgtttttgtaagttagt |
32668562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University