View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13386_low_39 (Length: 265)
Name: NF13386_low_39
Description: NF13386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13386_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 246
Target Start/End: Complemental strand, 53478490 - 53478260
Alignment:
| Q |
15 |
catcatcctttgagaagtgggattcaaatccatttaatatcatcaattacttcatgattgaattcaactaacttgtggttaatacatatagagaacctac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53478490 |
catcatcctttgagaagtgggattcaaatccatttaatatcatcaattacttcatgattgaattcaactaacttggggttaatacatatagagaacctac |
53478391 |
T |
 |
| Q |
115 |
ttggtacgtcacaattgaagagtctcacatggtgacttaatattcaacaaaaatgtttcattgattgataactcttcacatatgtaggttttcaacgtct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53478390 |
ttggtacgtcacaattgaagagtctcacatggtgacttaatattcaacaaaaatgtttcattgattgataactcttc-catatgtaggttttcaacgtct |
53478292 |
T |
 |
| Q |
215 |
taattttgaggtcattatttgtgttaagctat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53478291 |
taattttgaggtcattatttgtgttaagctat |
53478260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University