View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13386_low_44 (Length: 228)
Name: NF13386_low_44
Description: NF13386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13386_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 19797690 - 19797874
Alignment:
| Q |
20 |
tgcagttgtctgcatcattgctagaccaagtctaggacagg-aaagcaacatctagtgatgcttgatcaaagaaaacattggtaaactaaagaggtacct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19797690 |
tgcagttgtctgcatcattgctagaccaagtccaggacggggaaagcaacatctagtgatgcttgatcaaagaaaacattggtaaactaaagaggtacct |
19797789 |
T |
|
| Q |
119 |
ttttccaagctacttcatgcacgaaaactggaaattgacattaggaatgttgttagttaagtctgttagggagttagttggttcg |
203 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
19797790 |
ttttccaagctactgcatgtaggaaaactggaaattgacattaggaatgttcttagttaagtctgttggggagttagttgattcg |
19797874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University