View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13387_low_10 (Length: 227)
Name: NF13387_low_10
Description: NF13387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13387_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 4316796 - 4316595
Alignment:
| Q |
13 |
aagaatatggcactttataggaacacttttcagcattatcttcttactcttttcaataatcttaacttggtggttcttgtttcttgttcctttgtctttt |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316796 |
aagaaaatggcactttataggaacacttttcagcattatcttcttactcttttcaataatcttaacttggtggttcttgtttcttgttcctttgtctttt |
4316697 |
T |
|
| Q |
113 |
tatggatttgctttgtatagtcatttgttcattgaagagaattttcctgtgactattggatatccattttggtctctttattgtgatttgaagttgtttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316696 |
tatggatttgctttgtatagtcatttgttcattgaagagaattttcctgtgactattggatatccattttggtctctttattgtgatttgaagttgtttt |
4316597 |
T |
|
| Q |
213 |
tg |
214 |
Q |
| |
|
|| |
|
|
| T |
4316596 |
tg |
4316595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University