View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13388_low_2 (Length: 337)
Name: NF13388_low_2
Description: NF13388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13388_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 39 - 321
Target Start/End: Original strand, 31944658 - 31944939
Alignment:
| Q |
39 |
cacagaaacaaacaaactactagacgatcaaaatcaataactgcatggaatctaaatccgcacgcctaactgagctgccaccaaattgtcatgaaaactg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31944658 |
cacagaaacaaacaaactactagacgatcaaaatcaataactgcatggaatttaaatccgcacgcctaactgagctgccaccaaattgtcatgaaaactg |
31944757 |
T |
|
| Q |
139 |
ctgccacaactagagacatccccttggttgacttatcagcatggccatgggcttgtcctgcccaaatgtccactccaaacgggagttttccggtccctga |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31944758 |
ctgccacaactagagacatccccttggttgacttatcagcatggccatgggcgtgtcctgcccaaatgtccactccaaacgggagttttccggtccctga |
31944857 |
T |
|
| Q |
239 |
cttgatcgaactgcatgcactcaaatacatttctagttannnnnnnattttctacttaaaacaaaaaatcagaagattgaact |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31944858 |
cttgatcgaactgcatgcactcaaatacatttctagtta-ttttttattttctacttaaaacaaaaaatcagaagattgaact |
31944939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University