View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13388_low_3 (Length: 279)
Name: NF13388_low_3
Description: NF13388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13388_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 18389557 - 18389341
Alignment:
| Q |
19 |
aaaaggcggggatagtaataggtacacttatggcagctgccatattaggtttcattggaatggtttactggaagcgccgagttaacactagaagaaacca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
18389557 |
aaaaggcggggatagtaataggtacacttctgggagctgccatattaggtttcattggaatggtttgctggaagcgccgagttaacattagaagaaaccg |
18389458 |
T |
 |
| Q |
119 |
ttatagtgatgctgccagaaacattgaactttgatcttacaaattaaggatttgttttgtcctgaaacattttaattttactttcaaaatgcaaggaaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18389457 |
ttatagtgatgctgccagaaacattgaactttgatcttacaaattaaggatttgttttgtcctgaaacattttaattttactttcaaaatgcaaggaaac |
18389358 |
T |
 |
| Q |
219 |
ttcggaaaatggtcggg |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18389357 |
ttcggaaaatggtcggg |
18389341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University