View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13388_low_6 (Length: 229)

Name: NF13388_low_6
Description: NF13388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13388_low_6
NF13388_low_6
[»] chr1 (1 HSPs)
chr1 (32-77)||(30326449-30326494)


Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 32 - 77
Target Start/End: Original strand, 30326449 - 30326494
Alignment:
32 agtagttacactaacaacaaatatcgtaccacagaacaaaaaacaa 77  Q
    |||||||||||||||||||||||||||||||| |||||||||||||    
30326449 agtagttacactaacaacaaatatcgtaccactgaacaaaaaacaa 30326494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University