View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13389_low_15 (Length: 404)
Name: NF13389_low_15
Description: NF13389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13389_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 7 - 391
Target Start/End: Complemental strand, 10598843 - 10598459
Alignment:
| Q |
7 |
aaacaggtgtgaaacctaatgatgtcacatacattgcagttttatcggcatgtagtcatgttggtttgattgatgaggcatggaaacacttcacttcgat |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| || |
|
|
| T |
10598843 |
aaacaggtgtgaagcctaatgatgtcacatacattgcagttttatcggcatgtagtcatgttggtttaattgatgaagcatggaaacatttcacttccat |
10598744 |
T |
|
| Q |
107 |
gcgcgataaccatggaattgttccaaggatggagcattatgcatgtatggtcgatttgcttggtcgatcaggattgctttcagaagctattgaatttatt |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
10598743 |
gcgtgataaccatggaattgttccaaggatggagcattatgcatgtatggtcgatttgcttggtcgatccggattgctttcagaagcgattgaatttatt |
10598644 |
T |
|
| Q |
207 |
aactcaatgccttttgatgccgatgcgttggtgtggcgtacgtttcttggttcttgtcgggttcatcggaacaccaagcttggggaacatgctgcaaaaa |
306 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598643 |
aactcaatgccttttgatgccgacgcgttggtgtggcgtacgtttcttggttcttgtcgggttcatcggaacaccaagcttggggaacatgctgcaaaaa |
10598544 |
T |
|
| Q |
307 |
tgattcttgaacgagaacctcacgatccggctacatatatattattgtcgaacttgtatgcaacagaaggacggtgggatgatgt |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10598543 |
tgattcttgaacgagagcctcacgatccggctacctatatattattgtctaacttgtatgcaacagaaggacggtgggaagatgt |
10598459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 34 - 66
Target Start/End: Complemental strand, 14786247 - 14786215
Alignment:
| Q |
34 |
catacattgcagttttatcggcatgtagtcatg |
66 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
14786247 |
catatattgcagttttatcggcatgtagtcatg |
14786215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University