View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13389_low_18 (Length: 325)
Name: NF13389_low_18
Description: NF13389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13389_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 315
Target Start/End: Complemental strand, 37464023 - 37463728
Alignment:
| Q |
20 |
ataaaaccctttcgtaacttaacataagaaattttttctagaaaattagtagagtaaaaggaggccatcgtagtcactgccacatttgatgattgttcat |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
37464023 |
ataaaatcctttcgtaacttaacataagaagttttttctagaaaattagtagagtaaaaggaggccattgtagtcactgccacatttgatgattgttcct |
37463924 |
T |
 |
| Q |
120 |
tgccattcatctgagcactatgcattcacgaatcaattttgcgtttgtcttatctcccccgtcgcacaacagacctccctcttccatgaatatcatgtgt |
219 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37463923 |
tgccattcatccgagcactttgcattcacgaatcaattttacgtttgtccaatctcccccgtcgcacaacagacctccctcttccatgaatatcatgcgt |
37463824 |
T |
 |
| Q |
220 |
gtggacgttgttgtatcattcacagagaagtatgcctcccttttgtacctacgtgcaccctgttgataccttaaaccacgataaccctcgcctatg |
315 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37463823 |
gtggacgttgttgtatcattcagagagaagtatgcctcccttttgtacctacgtgcaccctgttgataccttaaaccacgataaccctcacctatg |
37463728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University