View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13389_low_23 (Length: 245)
Name: NF13389_low_23
Description: NF13389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13389_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 9 - 188
Target Start/End: Original strand, 27145498 - 27145677
Alignment:
| Q |
9 |
gagatgagtgactgaatcatcatttagatacttattctctctaatctcaaatataaacaacaaaaaatcatatttgatggtctcaaacataaacaaatgt |
108 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
27145498 |
gagatgaatgactgaatcataatttagatacttattctctctaatctcaaatataaacaacaaaaaatcatatttgatggtctcaaacataagcaaaggt |
27145597 |
T |
 |
| Q |
109 |
taactaactcaactaattaaatattaaaaatgctaagatcatctgcgatagagctcctattttttgttgcttaagcctta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
27145598 |
taactaactcaactaattaaatattaaaaatgctaagatcatctgcgatagagctcctatttttgggtgcttaagcctta |
27145677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 245
Target Start/End: Original strand, 27145701 - 27145760
Alignment:
| Q |
186 |
ttatacaatttatttaatgttctcatttaacaaataaaatctttccaatctaacaccttc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||| |||||||||| |||||| |
|
|
| T |
27145701 |
ttatacaatttatttaatgttctcatttaacaaaaaacatctctccaatctaagaccttc |
27145760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University