View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13389_low_26 (Length: 201)
Name: NF13389_low_26
Description: NF13389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13389_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 86 - 193
Target Start/End: Complemental strand, 3423239 - 3423132
Alignment:
| Q |
86 |
ggcagcggcattgttttgtccaatttctgaattgtgtttaagtcaaaaactagatcctttattgagtcattttcatgattttcaactttgtgatcctttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423239 |
ggcagcggcattgttttgtccaatttctcaattgtgtttaagtcaaaaactagatcctttattgagtcattttcatgattttcaactttgtgatcctttt |
3423140 |
T |
|
| Q |
186 |
ccttgtct |
193 |
Q |
| |
|
|||||||| |
|
|
| T |
3423139 |
ccttgtct |
3423132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 81
Target Start/End: Complemental strand, 3423347 - 3423298
Alignment:
| Q |
32 |
gctactgagcttaagccaagagacagtggtggcggtggaggtggtggtgg |
81 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3423347 |
gctactgagcttaagcctagagacagtggtggcggtggaggtggtggtgg |
3423298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University