View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13389_low_26 (Length: 201)

Name: NF13389_low_26
Description: NF13389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13389_low_26
NF13389_low_26
[»] chr2 (2 HSPs)
chr2 (86-193)||(3423132-3423239)
chr2 (32-81)||(3423298-3423347)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 86 - 193
Target Start/End: Complemental strand, 3423239 - 3423132
Alignment:
86 ggcagcggcattgttttgtccaatttctgaattgtgtttaagtcaaaaactagatcctttattgagtcattttcatgattttcaactttgtgatcctttt 185  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3423239 ggcagcggcattgttttgtccaatttctcaattgtgtttaagtcaaaaactagatcctttattgagtcattttcatgattttcaactttgtgatcctttt 3423140  T
186 ccttgtct 193  Q
    ||||||||    
3423139 ccttgtct 3423132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 81
Target Start/End: Complemental strand, 3423347 - 3423298
Alignment:
32 gctactgagcttaagccaagagacagtggtggcggtggaggtggtggtgg 81  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||    
3423347 gctactgagcttaagcctagagacagtggtggcggtggaggtggtggtgg 3423298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University