View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1338_high_1 (Length: 384)
Name: NF1338_high_1
Description: NF1338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1338_high_1 |
 |  |
|
| [»] scaffold0172 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 30 - 374
Target Start/End: Original strand, 1553469 - 1553813
Alignment:
| Q |
30 |
cttattgttcaatccatgttcatgtttacttataaacataaatcactttatattcaactcagttttcacttgttattgcggcagaataaaacgcacgctt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1553469 |
cttattgttcaatccatgttcatgtttacttataaacataaatcactttatattcaactcagttttcacttgttattgcggcagaataaaacccacgctt |
1553568 |
T |
 |
| Q |
130 |
agtttctttctgaattatgacttgtttaatgtttttcaattgtagactaccaggtgactttggttttgatccactaggccttggcaaggacccagcattt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1553569 |
agtttctttctgaattatgacttgtttaatgtttttcaattgtagactaccaggtgactttggttttgacccactaggccttggcaaggacccagcattt |
1553668 |
T |
 |
| Q |
230 |
ctgaaatggtacagagaagctgagcttattcatggaaggtgggcaatggctgcagttctaggcatctttgttggtcaagcatggagtggagttccatggt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553669 |
ctgaaatggtacagagaagctgagcttattcatggaaggtgggcaatggctgcagttctaggcatctttgttggtcaagcatggagtggagttccatggt |
1553768 |
T |
 |
| Q |
330 |
ttgaggctggagctgaccccaatgcaattgctccattctcctttg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553769 |
ttgaggctggagctgaccccaatgcaattgctccattctcctttg |
1553813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 63 - 95
Target Start/End: Original strand, 12110924 - 12110956
Alignment:
| Q |
63 |
aaacataaatcactttatattcaactcagtttt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
12110924 |
aaacataaatcactttatattcaactcactttt |
12110956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0172 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 63 - 95
Target Start/End: Complemental strand, 15317 - 15285
Alignment:
| Q |
63 |
aaacataaatcactttatattcaactcagtttt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
15317 |
aaacataaatcactttatattcaactcactttt |
15285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 63 - 95
Target Start/End: Complemental strand, 38510410 - 38510378
Alignment:
| Q |
63 |
aaacataaatcactttatattcaactcagtttt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
38510410 |
aaacataaatcactttatattcaactcactttt |
38510378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 63 - 95
Target Start/End: Complemental strand, 48045740 - 48045708
Alignment:
| Q |
63 |
aaacataaatcactttatattcaactcagtttt |
95 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
48045740 |
aaacataaatcactttatcttcaactcagtttt |
48045708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University