View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1338_low_7 (Length: 251)
Name: NF1338_low_7
Description: NF1338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1338_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 2490560 - 2490802
Alignment:
| Q |
1 |
tctctattattgttttcctatggccgtaacttaactatcgtgttacaatctacaaatgcttttcttatgtttagtttctgatgtcttaatgcattttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490560 |
tctctattattgttttcctatggccgtaacttaactatcgtgttacaatctacaaatgcttttcttatgtttagtttctgatgtcttaatgcattttcca |
2490659 |
T |
|
| Q |
101 |
ttttcattaattgttaaatgcagaacttatgcacaaccgctgcttatagacctgttagagagctaattcagcaagagatacaaaaggattcggtaacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490660 |
ttttcattaattgttaaatgcagaacttatgcacaaccgctgcttatagacctgttagagagctaattcagcaagagatacaaaaggattcggtaacttg |
2490759 |
T |
|
| Q |
201 |
gcaatttctctaaagatttactataatcctattatcctatgat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490760 |
gcaatttctctaaagatttactataatcctattatcctatgat |
2490802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 41589494 - 41589433
Alignment:
| Q |
117 |
aatgcagaacttatgcacaaccgctgcttatagacctgttagagagctaattcagcaagaga |
178 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| | || ||||||||| | ||||||||||||| |
|
|
| T |
41589494 |
aatgcagaacttgtgcacaactgctgcttatcggccagttagagagttgattcagcaagaga |
41589433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University