View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13390_low_12 (Length: 305)
Name: NF13390_low_12
Description: NF13390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13390_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 2571643 - 2571450
Alignment:
| Q |
18 |
gagattgagctaggagtaataagggtgctaagaggatgaaaaggagaagggaaagtgaaggtgacatgnnnnnnnggaagtataatgaaaggtggtttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
2571643 |
gagattgagctaggagtaataagggtgctaagaggatgaaaaggagaagggaaagtgaaggtgacatgtttttttggaagtttaatgaaaggtggtttga |
2571544 |
T |
|
| Q |
118 |
gtatgtgttattttgcttgtgggatgtgtttaggaataatggtagtactaggaatttataggcacatagacgaagttgttgagataaataaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571543 |
gtatgtgttattttgcttgtgggatgtgtttaggaataatggtagtactaggaatttataggcacatagacgaagttgttgagataaataaata |
2571450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 215 - 272
Target Start/End: Complemental strand, 2571256 - 2571199
Alignment:
| Q |
215 |
cctatctctaaatagtttatttggaaaataacattgtcactcttcaatgtgttattaa |
272 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
2571256 |
cctatctctaaatagtttatttgaaaaataacattgtcagtcttcaatgtgttattaa |
2571199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University