View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13392_high_2 (Length: 488)
Name: NF13392_high_2
Description: NF13392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13392_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 17 - 471
Target Start/End: Complemental strand, 32853090 - 32852635
Alignment:
| Q |
17 |
aatatgcggttatattcaatcacttggttatggagacccaaaaaatctaaaaactgannnnnnnn-cttcttataataaggaccaggaagtattgtattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
32853090 |
aatatgcggttatattcaatcacttggttatggagacccaaaaaatctaaaaactgatttttttttcttcttataataaggacgaggaagtattgtattt |
32852991 |
T |
|
| Q |
116 |
gaccataagtttaggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852990 |
gaccataagtttaggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcag |
32852891 |
T |
|
| Q |
216 |
ttttgcttttaataccctgttgtatccacattattctgtagcagtgtctttcaatgatatttcttggttttttgccagtacaaaacgcttgaagtttcca |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852890 |
ttttgcttttaataccctgttgtatccacattattctgtagcagtgtctttcaatgatatttcttggttttttgccagtacaaaacgcttgaagtttcca |
32852791 |
T |
|
| Q |
316 |
acttctctgctggattattgtatcatcctaataatctttgatcacccttctttcaggcgtttcattgtcggagggggaacgcatacctattcagtaaagc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852790 |
acttctctgctggattattgtatcatcctaataatctttgatcacccttctttcaggcgtttcattgtcggagggggaacgcatacctattcagtaaagc |
32852691 |
T |
|
| Q |
416 |
gtgagtacatttcagttcttattggataatccatcatcagtgactaaaattaaaat |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852690 |
gtgagtacatttcagttcttattggataatccatcatcagtgactaaaattaaaat |
32852635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University