View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13392_low_12 (Length: 390)
Name: NF13392_low_12
Description: NF13392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13392_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 373
Target Start/End: Original strand, 34478117 - 34478496
Alignment:
| Q |
1 |
agaggagaagaagggagagaataaatggtcaccttggaacattacgtggtcttgtggcttccactcatcaaaaggtatgttttgttccttctttttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34478117 |
agaggagaagaagggagagaataaatggtcaccttggaacattacgtggtcttgtggcttccactcatcaaaaggtatgttttgttccttctttttgttg |
34478216 |
T |
 |
| Q |
101 |
tcagttttataatttcattctaattgtaagattggtttagaattttatcaatatattatatttgaaaagttatgattaattaaaatagcagattcttgcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
34478217 |
tcagttttataatttcattctaattgtaagattggtttagaattttatcaatatattatatttgaaaagttatg----attaaaatagcggattcttgcg |
34478312 |
T |
 |
| Q |
201 |
taaaaagtaaacatatgcagcaccggcacttcatattgaaggtgatatgtggttacatcaaatcactttcatttgcttaaattattacggatatctatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34478313 |
taaaaagtaaacatatgcagcaccggcacttcatattgaaggtggtatgtggttacatcaaatcactttcatttgcttaaattattacggatatctatca |
34478412 |
T |
 |
| Q |
301 |
t-----------gtgtcggttatccgtgtctatattagtgtttctataaaatgcatgtgctgtggagatgagagagggaattat |
373 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34478413 |
tgtgtcaatatcgtgtcggttatccgtgtttatattagtgtttctataaaatgcatgtgttgtggagatgagaaagggaattat |
34478496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University