View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13392_low_16 (Length: 326)
Name: NF13392_low_16
Description: NF13392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13392_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 29 - 310
Target Start/End: Original strand, 26495271 - 26495552
Alignment:
| Q |
29 |
aaaactatgattattgaagaatccaaacctataaacatacctaatcttaacagaaagaggagtccaacattgtgtgaaaattatatcaccccttttggtt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495271 |
aaaactatgattattgaagaatccaaacctataaacatacctaatcttaacagaaagaggagtccaacattgtgtgaaaattatatcaccccttttggtt |
26495370 |
T |
|
| Q |
129 |
ccaaaaagccaatactccctcaaacatttctcatcaccatcctccaaaactctccttatagccaattccctcctcatcataggatccaacaccttcatgg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495371 |
ccaaaaagccaatactccctcaaacatttctcatcaccatcctccaaaactctccttatagccaattccctcctcatcataggatccaacaccttcatgg |
26495470 |
T |
|
| Q |
229 |
aaaccacaccaacagcaccaccactcttccatggcacaatctttgccggaacgcgcaccaccgtgcctttccgatgatgatg |
310 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495471 |
aaaccacaccaacaccaccaccactcttccatggcacaatctttgccggaacgcgcaccaccgtgcctttccgatgatgatg |
26495552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University