View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13392_low_18 (Length: 307)
Name: NF13392_low_18
Description: NF13392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13392_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 57 - 296
Target Start/End: Original strand, 33114902 - 33115141
Alignment:
| Q |
57 |
ctacagttgtgtgatcaatttcttaaatgtccaaaagctgctcttttcaatgcaaaatttctacattcaagtaccttaacatgtgcccttatggcaaggg |
156 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33114902 |
ctacagttgtgtaatcaatttcttaaatgtccaaaagctgctcttttcaatgcaaaatttctacattcaagtaccttaacatgtgcccttatggcaaggg |
33115001 |
T |
|
| Q |
157 |
cacatggtagcacccttgatgaaattacctatgtagcaccaaccttcaaatttccannnnnnncaaactatcaacggcgttgaagtgttagtgccatgtc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33115002 |
cacatggtagcacccttgatgaaattacctatgtagcaccaaccttcaaatttccatttttttcaaactatcatcggcgttgaagtgttagtgccatgtc |
33115101 |
T |
|
| Q |
257 |
tcgtgtaggtgtcacagtttcatagcaacataacattcat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33115102 |
tcgtgtaggtgtcacagtttcatagcaacataacattcat |
33115141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University