View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13392_low_24 (Length: 214)
Name: NF13392_low_24
Description: NF13392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13392_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 54 - 195
Target Start/End: Complemental strand, 45130326 - 45130185
Alignment:
| Q |
54 |
atggcaatgacaatgtctatgttatttcttcatctcannnnnnnnaccatgaaagtgttttgtttttctcctcattttcatgcagacaaaattgttaccc |
153 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45130326 |
atggcaatgacaatgtctattttatttcttcatctcattttttttaccatgaaagtgttttgtttctctcctcattttcatgcagacaaaattgttaccc |
45130227 |
T |
|
| Q |
154 |
ttcctggacaaccacaaaacatagcctttcaacaattctcag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45130226 |
ttcctggacaaccacaaaacatagcctttcaacaattctcag |
45130185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University