View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13392_low_7 (Length: 411)
Name: NF13392_low_7
Description: NF13392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13392_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 120 - 395
Target Start/End: Complemental strand, 36773786 - 36773511
Alignment:
| Q |
120 |
ctgcaggcgacacacggacgatgatggagtatcaaagtgactacttgatgttgtaactgatgtaattgcatatcattatttacagcattgtagtagtatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36773786 |
ctgcaggcgacacacggacgatgatggaggatcaaagtgactacttgatgttgtaactgatgtaattgcatatcattatttacagcattgtagtagtatg |
36773687 |
T |
 |
| Q |
220 |
aatatctcttattccattgcataaaaataaaaatagtatttgacacattttgatagttacatatttccattttgatatatcaaaaaattttacattactt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36773686 |
aatatctcttattccattgcataaaaataaaaatagtatttgacacattttgatagttacatatttccattttgatatatcaaaaaaatttacattactt |
36773587 |
T |
 |
| Q |
320 |
tagaatcaagcctaagtataatttttaaacacacttttaaaggaaaaaccctatgatgacccgattttcattcaac |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36773586 |
tagaatcaagcctaagtataatttttaaacacacttttaaaggaaaaaccctatgatgacccgattttcgttcaac |
36773511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 36773902 - 36773864
Alignment:
| Q |
19 |
tgtttaatgtcgtatggggcacgtttaaaattaatggca |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36773902 |
tgtttaatgtcgtatggggcacgtttaaaatcaatggca |
36773864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University