View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13393_high_14 (Length: 270)
Name: NF13393_high_14
Description: NF13393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13393_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 254
Target Start/End: Original strand, 42071149 - 42071404
Alignment:
| Q |
7 |
tgagatgaaaaaagtaagtcccaaataagaatatcccacaggcttttttagctatctttatggttggtatagattctatgataatccacaacctgcaagc |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42071149 |
tgagatgaaaaaagtaagtgccaaataagaatatcccaaaggctttttgagctatatttatggttggtatagattctatgataatccacaacctgcaagc |
42071248 |
T |
 |
| Q |
107 |
atgaaggatgtaagggtgaaatgttcttagacccatacttgataaagattagaatactagtatatgatgttccatttctatttaaattaagctcatcttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42071249 |
atgaaggatgtaagggtgaaatgttcttagacccatacttgataaagattagaatactagtatatgatgttccatttctatttaaattaaggtcatcttg |
42071348 |
T |
 |
| Q |
207 |
tttat--------tgcaaaattataatagttgatgtgaattttcatttattatttt |
254 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42071349 |
tttattattttaatgcaaaattataatagttgatgtgaattttcatttattatttt |
42071404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University