View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13393_high_17 (Length: 225)
Name: NF13393_high_17
Description: NF13393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13393_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 4211561 - 4211778
Alignment:
| Q |
1 |
atggatttgagtctttgtaaaacagaaggagatctaaagagttgttggtgatggggttgttgaaagttaggatcttgttgttggagatgtttttgggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211561 |
atggatttgagtctttgtaaaacagaaggagatctaaagagttgttggtgatggggttgttgaaagttaggatcttgttgttggagatgtttttgggtgg |
4211660 |
T |
|
| Q |
101 |
cattggcaagagtggaagtgatgtaaatggtagctatgacaagttgaaggaggaggaagaagatggtgggagtaaaccagctgtagagaccagcccagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211661 |
cattggcaagagtggaagtgatgtaaatggtagctatgacaagttgaaggaggaggaagaagatggtgggagtaaaccagctgtagagaccagcccagaa |
4211760 |
T |
|
| Q |
201 |
tgttggtgatgatgatgt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4211761 |
tgttggtgatgatgatgt |
4211778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 4211423 - 4211458
Alignment:
| Q |
1 |
atggatttgagtctttgtaaaacagaaggagatcta |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4211423 |
atggatttgagtctttgtaaaacagaaggagatcta |
4211458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University