View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13393_high_18 (Length: 220)

Name: NF13393_high_18
Description: NF13393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13393_high_18
NF13393_high_18
[»] chr7 (1 HSPs)
chr7 (36-200)||(19682622-19682786)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 36 - 200
Target Start/End: Original strand, 19682622 - 19682786
Alignment:
36 aatctggatatggttctaactctcaaagatggtgtcaaatctcttgcctctgtcgttgtcttattcatgtctctctgatttggaaatagacagtttggct 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||  ||||||||||||||||||| |||||||||||||    
19682622 aatctggatatggttctaactctcaaagatggtgtcaaatctcttgcttctgtcgttgtcttatttgtgtctctctgatttggaaacagacagtttggct 19682721  T
136 cgaaagggtgtttagatttgtttttgttttgcagggagtgtggtacttggatccttctatgatgg 200  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
19682722 tgaaagggtgtttagatttgtttttgttttgcagggagtgtggtacttggatccttctgtgatgg 19682786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University