View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13393_low_23 (Length: 220)
Name: NF13393_low_23
Description: NF13393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13393_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 36 - 200
Target Start/End: Original strand, 19682622 - 19682786
Alignment:
| Q |
36 |
aatctggatatggttctaactctcaaagatggtgtcaaatctcttgcctctgtcgttgtcttattcatgtctctctgatttggaaatagacagtttggct |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
19682622 |
aatctggatatggttctaactctcaaagatggtgtcaaatctcttgcttctgtcgttgtcttatttgtgtctctctgatttggaaacagacagtttggct |
19682721 |
T |
 |
| Q |
136 |
cgaaagggtgtttagatttgtttttgttttgcagggagtgtggtacttggatccttctatgatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19682722 |
tgaaagggtgtttagatttgtttttgttttgcagggagtgtggtacttggatccttctgtgatgg |
19682786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University