View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13393_low_26 (Length: 210)
Name: NF13393_low_26
Description: NF13393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13393_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 34705665 - 34705843
Alignment:
| Q |
19 |
gacatggaaggaatgatggctacattttggcgatgaaacnnnnnnnnn-aagaaaggttttgaaacttgtttggagagctcaatgaaaataattatttca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34705665 |
gacatggaaggaatgatggctacattttggcgatgaaacttttttttttaagaaaggttttgaaacttatttggagagctcaatgaaaataattatttca |
34705764 |
T |
 |
| Q |
118 |
agtgttgcttgttttttatcgagtcttcgtgaatatatgctaataaattggatcaatttattgttggtattgtttgtat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34705765 |
agtgttgcttgttttttatcgagtcttcgtgaatatatgctaataagttggatcaatttattgttggtattgtttgtat |
34705843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University