View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13394_high_9 (Length: 237)
Name: NF13394_high_9
Description: NF13394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13394_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 9 - 146
Target Start/End: Complemental strand, 41752669 - 41752532
Alignment:
| Q |
9 |
acatcatcaccacttgagtttggaatagaagtccaattagaaggattaggacccaacacagaaactagaccagcaactattatgagtggaaccataaaca |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752669 |
acatcatcaccacttgggtttggaatagaagtccaattagaaggattaggacccaacacggaaactagaccagcaactattatgagtggaaccataaaca |
41752570 |
T |
 |
| Q |
109 |
ataagagtttcacggatgaagatgaatatgattctaaa |
146 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41752569 |
ataagagtttcatggatgaagatgaatatgattctaaa |
41752532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University