View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13394_high_9 (Length: 237)

Name: NF13394_high_9
Description: NF13394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13394_high_9
NF13394_high_9
[»] chr7 (1 HSPs)
chr7 (9-146)||(41752532-41752669)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 9 - 146
Target Start/End: Complemental strand, 41752669 - 41752532
Alignment:
9 acatcatcaccacttgagtttggaatagaagtccaattagaaggattaggacccaacacagaaactagaccagcaactattatgagtggaaccataaaca 108  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
41752669 acatcatcaccacttgggtttggaatagaagtccaattagaaggattaggacccaacacggaaactagaccagcaactattatgagtggaaccataaaca 41752570  T
109 ataagagtttcacggatgaagatgaatatgattctaaa 146  Q
    |||||||||||| |||||||||||||||||||||||||    
41752569 ataagagtttcatggatgaagatgaatatgattctaaa 41752532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University