View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13394_low_2 (Length: 639)
Name: NF13394_low_2
Description: NF13394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13394_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 574; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 574; E-Value: 0
Query Start/End: Original strand, 19 - 624
Target Start/End: Complemental strand, 29703642 - 29703038
Alignment:
| Q |
19 |
acaatagttaaacataatgagatccagcataccgttttcagtctcaattgagcccccttcattctgggagacactcatttcttcagaaacattatcattc |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29703642 |
acaatagttaaacataatgagatc-agcataccgttttcagtctcaattgagcccccttcattctgggagacactcatttcttcagaaacatcatcattc |
29703544 |
T |
|
| Q |
119 |
ttggttgattccatgtcctcagtgtccgccaaactcatcttcgacaagctcttccccaccaatctcactgaccttctggtgctgtatgctttctgcactg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29703543 |
ttggttgattccatgtcctcagtgtccgccaaactcatcttcgacaagctcttccccaccaatctcactgaccttctggtgctgtatgctttctgcactg |
29703444 |
T |
|
| Q |
219 |
aagttccatcagagatctcagttttgttccgagcagaacgaccagctctggttctactgctgggagctgcagcaggagttttggccacatccgttgcctt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29703443 |
aagttccatcagagatctcagttttgttccgaacagaacgaccagctctggtcctactgctgggagctgcagcaggagttttggccacatccgttgcctt |
29703344 |
T |
|
| Q |
319 |
tccttgcacctcactcacaacatcatcttcatcttctatcacaatcacttccttctttctccgagtagaaacagcaggaacccttctcctgctagttggc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29703343 |
tccttgcacctcactcacaacatcatcttcatcttctatcacaatcacttccttctttctccgagtagaaacagctggaacccttctcctgctagttggc |
29703244 |
T |
|
| Q |
419 |
acaacagcaggagtaccggcatcaacattagcatctaagttctcttgctcaacttccccttcagcaactccacctcttcccccacggttaacccttgtag |
518 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29703243 |
acaacagcaggagtaccggcatcaacattagcatctaagttctcttgctcaacttccccttcagcaactccacctcttcccccacggttaacccttgtag |
29703144 |
T |
|
| Q |
519 |
aaaccttagtgctttcagcttctttcaccggtttcctttgagtcgtagttctacgagctgttcgtggttgaacagctggtgtaccaatatcaccaccttc |
618 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29703143 |
aaaccttagtgctttcagcttctttcaccggtttcctttgagtcgtagttctgcgagctgttcgtggttgaacagccggtgtaccaatatcaccaccttc |
29703044 |
T |
|
| Q |
619 |
cctttg |
624 |
Q |
| |
|
|||||| |
|
|
| T |
29703043 |
cctttg |
29703038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University