View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13394_low_8 (Length: 280)
Name: NF13394_low_8
Description: NF13394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13394_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 55300373 - 55300623
Alignment:
| Q |
13 |
aatatctcttcatcactgcgacctatcctcgtttcatcatccccccacagtagtccttactacaaaggtcttaccgattactctcttgtcattgatgcct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55300373 |
aatatctcttcatcactgcgacctatcctcctttcatcatccccccacagtagtccttactacaaaggtcttaccgattattctcttgtcattgatgcct |
55300472 |
T |
|
| Q |
113 |
cttgggccactcctcatccccacccccatcacaactcatccctttcttgttatcacgactcaagtccatactataggggtcttattgctcttcctgttcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300473 |
cttgggccactcctcatccccacccccatcataactcatccctttcttgttatcacgactcaagtccatactataggggtcttattgctcttcctgttcc |
55300572 |
T |
|
| Q |
213 |
cacttccccctcctctctcttctccctcaacatcaatttcaataccacccc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300573 |
cacttccccctcctctctcttctccctcaacatcaatttcaataccacccc |
55300623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University