View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13395_low_21 (Length: 362)
Name: NF13395_low_21
Description: NF13395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13395_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 2 - 353
Target Start/End: Complemental strand, 24690798 - 24690447
Alignment:
| Q |
2 |
gaccatccctcccctccaaagttttatgaccttgacattttcttaggtagcgagctcacttggttcaaggtgatgcaccatgtaaaggttgcaccaaggc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690798 |
gaccatccctcccctccaaagttttatgaccttgacattttcttaggtagcgagctcacttggttcaaggtgatgcaccatgtaaaggttgcaccaaggc |
24690699 |
T |
|
| Q |
102 |
aaagtcaaactgatggtccttgctctgaagtgtgaatcagtggtatggaccagttcttaagatcaactcttcgcaatgtgagtgcagtaatcatcagacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690698 |
aaagtcaaactgatggtccttgctctgaagtgtgaatcagtggtatggaccagttcttaagatcaactcttcgcaatgtgagtgcagtaatcatcagacc |
24690599 |
T |
|
| Q |
202 |
atcactgcgcaggcctagatgaccagtatgaatattatgaggttcagtatgcagatcatggatcttcagttcactaacaaagttacactgaaatattatt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690598 |
atcactgcgcaggcctagatgaccagtatgaatattatgaggttcagtatgcagatcatggatcttcagttcactaacaaagttacactgaaatattatt |
24690499 |
T |
|
| Q |
302 |
tgttttgatgactctcgaagtccacatgatgctattgttgtttcatctcagt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24690498 |
tgttttgatgactctcgaagtccacatgatgctattgttgtttcatttcagt |
24690447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 14 - 110
Target Start/End: Complemental strand, 10330785 - 10330688
Alignment:
| Q |
14 |
cctccaaagttttatgaccttgacattttcttaggtagcgagctcacttgg-ttcaaggtgatgcaccatgtaaaggttgcaccaaggcaaagtcaaa |
110 |
Q |
| |
|
||||||||| ||||||||||||| || || |||||| || ||||||||| |||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
10330785 |
cctccaaagctttatgaccttgatatcgactcaggtagtgacctcacttgggttcagtgtgatgcaccatgtaaaggttgcactaaggtaaagtcaaa |
10330688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University