View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13395_low_24 (Length: 310)
Name: NF13395_low_24
Description: NF13395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13395_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 301
Target Start/End: Complemental strand, 44801731 - 44801453
Alignment:
| Q |
20 |
caagcttcatcacaactcatgtaggttttaggaagaaagaaaatctagcgtcaaggaaatgtctacggctataagttgattagaatatgaactagtgaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44801731 |
caagcttcatcacaactcatgtaggttttaggaagaaagaaaatctagtgtcaaggaaatgtctacggctataagttgattag---atgaactagtgaac |
44801635 |
T |
 |
| Q |
120 |
cggacaaactaaaccaatctaatatgtaaaatacaacgagcactatgcaaatagnnnnnnnaattaaattgtagtaaaatttatgtcttacatatgtgat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801634 |
cggacaaactaaaccaatctaatatgtaaaatacaacgagcactatgcaaatagtttttttaattaaattgtagtaaaatttatgtcttacatatgtgat |
44801535 |
T |
 |
| Q |
220 |
ggtnnnnnnnngtccactttcacacggtccctttcataagaaaccatctctctcaaacacttagaaaccctaactttcatct |
301 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801534 |
ggtaaaaaaaagtccactttcacacggtccctttcataagaaaccatctctctcaaacacttagaaaccctaactttcatct |
44801453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University