View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13396_high_6 (Length: 391)
Name: NF13396_high_6
Description: NF13396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13396_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 109 - 367
Target Start/End: Complemental strand, 53679605 - 53679347
Alignment:
| Q |
109 |
acctgcttaatcaacattgaatcacctttcttactttcgtttgattttcttgaaaatccatccatttagatcagaaatagaacctaattgaattgatttt |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53679605 |
acctgcttaatcaacaccgaatcacctttcttactttcgtttgattttcttgaaaatccatccatttagatcagaaatagaacctaattgaattgatttt |
53679506 |
T |
 |
| Q |
209 |
acatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaagtttcaattttgttcaccacgtttaacgttttaaatatgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53679505 |
acatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaaatttcaattttgttcaccatgtttaacgttttaaatatgt |
53679406 |
T |
 |
| Q |
309 |
catgtttcagttctgtttttaagctagttatattctggttcaatttcacttcttgttaa |
367 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53679405 |
tatgtttcagttttgtttttaagctagttatattctggttcaatttcagttcttgttaa |
53679347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University