View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13397_high_3 (Length: 249)
Name: NF13397_high_3
Description: NF13397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13397_high_3 |
 | |
|
| [»] scaffold0173 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0173 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: scaffold0173
Description:
Target: scaffold0173; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 2792 - 2992
Alignment:
| Q |
1 |
ttagatatgacaccacaagatgaatcatcaatcacggcaaatgatgcaactgtcaaagatatggagggatcagttgttgcttatgttgctgaccttctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2792 |
ttagatatgacaccacaagatgaatcatcaatcacgacaaatgatgcaactgtcaaagatatggagggatcagttgttgcttatgttgctgaccttctta |
2891 |
T |
|
| Q |
101 |
aagtccctgcaatttttgtaaaagttgtgactgattttattgacggtgacagacaaactgttgaagaattttggcaaaatttgactggtgtaacttctgc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
2892 |
aagttcctgcaatttttgtaaaagttgtgactgattttattgacggtgacaaacaaactgttgaagaattccggcaaaatttgactggtgtaacctctgc |
2991 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
2992 |
a |
2992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 65 - 201
Target Start/End: Original strand, 55108758 - 55108894
Alignment:
| Q |
65 |
agggatcagttgttgcttatgttgctgaccttcttaaagtccctgcaatttttgtaaaagttgtgactgattttattgacggtgacagacaaactgttga |
164 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||| || ||||| ||| |
|
|
| T |
55108758 |
agggagcagctgttgcttatgttgctgaccttcttaaagttcctgcaatttttgtaaaagctgtgactgatattattgacggtgacaaaccaactgctga |
55108857 |
T |
|
| Q |
165 |
agaattttggcaaaatttgactggtgtaacttctgca |
201 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
55108858 |
agaattcctacaaaatttggctgctgtaacttctgca |
55108894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 55108501 - 55108567
Alignment:
| Q |
1 |
ttagatatgacaccacaagatgaatcatcaatcacggcaaatgatgcaactgtcaaagatatggagg |
67 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55108501 |
ttagatatgacaccgcaggatgaatcatcaatcacggcaaatgatgcaactgtcaaagatatggagg |
55108567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University