View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13397_high_4 (Length: 237)
Name: NF13397_high_4
Description: NF13397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13397_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 12931236 - 12931151
Alignment:
| Q |
142 |
tgttgtgttttgatgtaaatacatatttggttaatggtgatgaaaagatggatctagaaatggtatgtt-ggtggcgatgatgatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12931236 |
tgttgtgttttgatgtaaatacatatttggttaatgatggtgagaagatggatctagaaatggtatgttgggtggcgatgatgatg |
12931151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University