View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13397_low_2 (Length: 395)
Name: NF13397_low_2
Description: NF13397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13397_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 199 - 365
Target Start/End: Complemental strand, 14176254 - 14176078
Alignment:
| Q |
199 |
gacatttgatatgttgtggtatgagttcaaatatacaatttcctacggctaggccgtaagtctatgcgagtttcactgctagactcttaaaaacaaa--- |
295 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14176254 |
gacattcgatatgttgtggtatgagttcaaatatacaatttcctacggctaggccgtaagtctatgcgagtttcaccgctagactcttaaaaacaaaaca |
14176155 |
T |
|
| Q |
296 |
-------acaatataatagaagcaaatgcaaagcaacgtataagaaaagaatcccagatcatcgatcccagtgaaat |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
14176154 |
aaacaaaacaatataatagaagcaaatgcaaagcaacgtataagaaaagaatcccagatcatggatcccattgaaat |
14176078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 11 - 108
Target Start/End: Complemental strand, 14176442 - 14176345
Alignment:
| Q |
11 |
agaatatcggaggtttggaaacaaaattctcaaatttctattgtgaagttatatttttagattttagaacgagaagattaaaattgtgaatcaacaag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14176442 |
agaatatcggaggtttggaaacaaaattctcaaatttctattgtgaaattatatttttagattttagaacgagaagattaaaattgtgaatcaacaag |
14176345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University