View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13399_high_6 (Length: 266)
Name: NF13399_high_6
Description: NF13399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13399_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 7658139 - 7658180
Alignment:
| Q |
1 |
tgatttagggtcaattttaatctgaaagtatcatctaaattg |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7658139 |
tgatttagggtcaattttaatctgaaagtatcatctaaattg |
7658180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 247
Target Start/End: Original strand, 7658351 - 7658388
Alignment:
| Q |
210 |
cccttctttatgagtttcttcatagattcatccttttt |
247 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7658351 |
cccttttttatgagtttcttcatagattcatccttttt |
7658388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University