View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13399_low_5 (Length: 364)
Name: NF13399_low_5
Description: NF13399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13399_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 106 - 330
Target Start/End: Original strand, 38112295 - 38112519
Alignment:
| Q |
106 |
gtgctttgaaactgagtattacttcacaacgtaaagcttaatttgtttgaattttggttatgattttgaacttcattttttcaactcataagccctaatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38112295 |
gtgctttgaaactgagtattacttcataacgtaaagcttaatttgtttgaattttggttatgattttgaacttcattttttcaactcataagccctagtt |
38112394 |
T |
|
| Q |
206 |
tatatccctaaatctggaaaatatttgggttatgaatttggttaagattttgaactttgttttttcaactcataaaccctaatttatagccctaaatctg |
305 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38112395 |
tatagccctaaatctggaagatattttggttatgaatttggttaagattttgaactttgttttttcaactcataaaccctaatttatagccctaaatctg |
38112494 |
T |
|
| Q |
306 |
gaaaatatttttctgtgtttatgtt |
330 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38112495 |
gaaaatatttttctgtgtttatgtt |
38112519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University