View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1339_low_14 (Length: 406)
Name: NF1339_low_14
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1339_low_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 30 - 406
Target Start/End: Complemental strand, 52585174 - 52584796
Alignment:
| Q |
30 |
gttttgacaccatatcccaagtggtcataaatttaagtatgattttggcatgtgcagtgtatagtaatagtactcctccaagttagttt-gagctatcac |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52585174 |
gttttgacaccatatcccaagtggtcataaatttaagtatgattttggcatgtgcagtgtatagtaatagtactcctccaagttagttttgagctatcac |
52585075 |
T |
|
| Q |
129 |
atttatcttactgaatactagagctgcaatattcaaacatgaaacttgggatttgattgtgaccactgattatgctcaccaatgaatccactgctcaacc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52585074 |
atttatcttactgaatactagagctgcaatattcaaacatgaaacttgggatttgattgtgaccactgattatgctcaccaatgaatccactgctcaacc |
52584975 |
T |
|
| Q |
229 |
tcaatagggcttcgtgcacctagtacggattcaccacctctatgttaatgtcttattaactcatgtcatcagaatatatactatactagct-ttttgctc |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
52584974 |
tcaatagggcttcgtgcacctagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagcttttttgctc |
52584875 |
T |
|
| Q |
328 |
aaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctctttttc |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52584874 |
aaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctccttttc |
52584796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University