View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1339_low_15 (Length: 406)
Name: NF1339_low_15
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1339_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 158 - 391
Target Start/End: Complemental strand, 51118499 - 51118267
Alignment:
| Q |
158 |
cgtaagatgacatgtcatcgtatttcaaggttcccaatgcttaaaaatataatcagcacctaggaagaagttcacaatctaattctttcaacaacttttg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51118499 |
cgtaagatgacatgtcatcgtatttcaaggttcccaatgcttaaaaatataatcagcacctaggaagaagttcacaatctaattctttcaacaacttttg |
51118400 |
T |
|
| Q |
258 |
gtattctcttcctttgcttccatcactagttcctcttccactatggcctcaaagagagtaaaggggaggaaactatctaagattaggtagtccgaccaca |
357 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51118399 |
gtattctctttatttgcttccatcactagttcctcttccactatggcctcaaagagagtaaaggggagg-aactatctaagattaggtagtccgaccaca |
51118301 |
T |
|
| Q |
358 |
gtttctaatcttaaatgcctagtttggtcttata |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51118300 |
gtttctaatcttaaatgcctagtttggtcttata |
51118267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 116
Target Start/End: Complemental strand, 51118578 - 51118541
Alignment:
| Q |
79 |
cataggcaattgttctaaaactcctttaattttggatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51118578 |
cataggcaattgttctaaaactcctttaattttggatc |
51118541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 113
Target Start/End: Original strand, 1298676 - 1298712
Alignment:
| Q |
77 |
atcataggcaattgttctaaaactcctttaattttgg |
113 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1298676 |
atcatagacaattgttctaaaactcctctaattttgg |
1298712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University