View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1339_low_24 (Length: 342)

Name: NF1339_low_24
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1339_low_24
NF1339_low_24
[»] chr6 (1 HSPs)
chr6 (137-255)||(2384990-2385108)


Alignment Details
Target: chr6 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 2384990 - 2385108
Alignment:
137 gtgttatcagttgagcaaacggtatgaaaattctgtcgtataacggcatcaatagtataatggacaaggttatagcactttggagtgtggcgggtggtat 236  Q
    |||||||||| || || ||||||||||||||||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||    
2384990 gtgttatcagctgcgcgaacggtatgaaaattctgttgtataacggcatcaatagtattatagacaatgttatagcactttggagtgtggcgggtggtat 2385089  T
237 cttgaaatttgaacctatg 255  Q
    |||||||||||||||||||    
2385090 cttgaaatttgaacctatg 2385108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University