View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1339_low_27 (Length: 340)
Name: NF1339_low_27
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1339_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 215 - 319
Target Start/End: Original strand, 30744048 - 30744152
Alignment:
| Q |
215 |
taaaattaatatttcattgatattgtatgcgacttataattttaaacaaannnnnnnnnctaaaaccaacaatttggtacggagtcggtacatcttttaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30744048 |
taaaattaatatttcattgatattgtatgcgacttataattttagacaattttttttttctaaaaccaacaatttggtacggagtcagtacatcttttaa |
30744147 |
T |
|
| Q |
315 |
taatt |
319 |
Q |
| |
|
||||| |
|
|
| T |
30744148 |
taatt |
30744152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 78 - 148
Target Start/End: Original strand, 30743911 - 30743981
Alignment:
| Q |
78 |
cgaagaatatcggatcccaattgatgggatgagtaagatattttacaaaattgtccttcattaattgtatg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30743911 |
cgaagaatatcggatcccaattgatgggatgagtaagatattttacaaaattgtccttccataattgtatg |
30743981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University