View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1339_low_35 (Length: 302)
Name: NF1339_low_35
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1339_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 88 - 130
Target Start/End: Original strand, 33456723 - 33456765
Alignment:
| Q |
88 |
gaataaatttagtagacaattatcaaaccctaattcaaatcaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456723 |
gaataaatttagtagacaattatcaaaccctaattcaaatcaa |
33456765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 165 - 206
Target Start/End: Original strand, 33456800 - 33456841
Alignment:
| Q |
165 |
cttcttcatcttcttcaaaagatgtttcacctttgtcacctg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456800 |
cttcttcatcttcttcaaaagatgtttcacctttgtcacctg |
33456841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University