View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1339_low_41 (Length: 269)

Name: NF1339_low_41
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1339_low_41
NF1339_low_41
[»] chr5 (1 HSPs)
chr5 (42-240)||(6285023-6285223)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 42 - 240
Target Start/End: Complemental strand, 6285223 - 6285023
Alignment:
42 atcatcaaaacccttatcgcaagtagatgccatggctaaaggtagctaatagcacaataattaatgaagaggagaaaaagaatgatatactgcttttagt 141  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||     
6285223 atcagcaaaacccttatcgcaagtagatgccatggctaaaggtagctaatagcacaataattaatgaagaggagagaaagaatgatatactgcttttagc 6285124  T
142 ctatggttgagagtgtcttgactcttgactatagttaagtata--tatagctgtagagacacgtttatttttgttgtaactagttaattaatacgagtat 239  Q
    |||||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6285123 ctatggttgagagtgtcttgactcttgattatagttaagtatatatatagctgtagagacacgtttatttttgttgtaactagttaattaatacgagtat 6285024  T
240 a 240  Q
    |    
6285023 a 6285023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University