View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1339_low_42 (Length: 265)
Name: NF1339_low_42
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1339_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 33456629 - 33456765
Alignment:
| Q |
1 |
gtgttgttaatgtgttgaggaattcaaaatatgttaaagctgctcaagaattgttggaagagttttgtagtgttggaaggggtcaattcaagaagaataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33456629 |
gtgttgttaatgtgttgaggaattcaaaatatgttaaagctgctcaagaattgttggaagagttttgcagtgttggaaggggtcaattcaagaagaataa |
33456728 |
T |
 |
| Q |
101 |
atttagtagacaattatcaaaccctaattcaaatcaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456729 |
atttagtagacaattatcaaaccctaattcaaatcaa |
33456765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 33456800 - 33456841
Alignment:
| Q |
172 |
cttcttcatcttcttcaaaagatgtttcacctttgtcacctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456800 |
cttcttcatcttcttcaaaagatgtttcacctttgtcacctg |
33456841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 7066368 - 7066304
Alignment:
| Q |
21 |
aattcaaaatatgttaaagctgctcaagaattgttggaagagttttgtagtgttggaaggggtca |
85 |
Q |
| |
|
|||||||||||| | ||| || ||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
7066368 |
aattcaaaatatatgaaacctactcaagaattgcttcaagagttttgcagtgttggaaggggtca |
7066304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University