View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1339_low_65 (Length: 212)

Name: NF1339_low_65
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1339_low_65
NF1339_low_65
[»] chr2 (1 HSPs)
chr2 (52-190)||(44909215-44909353)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 52 - 190
Target Start/End: Complemental strand, 44909353 - 44909215
Alignment:
52 gaaagttttatacaatcattggtacaccatcagtaaatgaatatcttttggaaattcagcatacaaccaaccaactctatcttggtgtctcatcatttga 151  Q
    ||||||||||||||||||||||||||||  || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44909353 gaaagttttatacaatcattggtacacctccaataaatgaatattttttggaaattcagcatacaaccaaccaactctatcttggtgtctcatcatttga 44909254  T
152 agcctccaataaaaaatgtagatatctctattcagaagt 190  Q
    |||||||||||||||||||||||||||||||||||||||    
44909253 agcctccaataaaaaatgtagatatctctattcagaagt 44909215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University