View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1339_low_65 (Length: 212)
Name: NF1339_low_65
Description: NF1339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1339_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 52 - 190
Target Start/End: Complemental strand, 44909353 - 44909215
Alignment:
| Q |
52 |
gaaagttttatacaatcattggtacaccatcagtaaatgaatatcttttggaaattcagcatacaaccaaccaactctatcttggtgtctcatcatttga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909353 |
gaaagttttatacaatcattggtacacctccaataaatgaatattttttggaaattcagcatacaaccaaccaactctatcttggtgtctcatcatttga |
44909254 |
T |
 |
| Q |
152 |
agcctccaataaaaaatgtagatatctctattcagaagt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909253 |
agcctccaataaaaaatgtagatatctctattcagaagt |
44909215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University